slc45a2

Ensembl ID:
ENSDARG00000002593
ZFIN ID:
ZDB-GENE-050208-97
Description:
membrane-associated transporter protein [Source:RefSeq peptide;Acc:NP_001103847]
Human Orthologue:
SLC45A2
Human Description:
solute carrier family 45, member 2 [Source:HGNC Symbol;Acc:16472]
Mouse Orthologue:
Slc45a2
Mouse Description:
solute carrier family 45, member 2 Gene [Source:MGI Symbol;Acc:MGI:2153040]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37277 Nonsense Mutation detected in F1 DNA During 2018
sa16467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030887 Nonsense 66 554 1 7
Genomic Location (Zv9):
Chromosome 21 (position 18274055)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19409544
GRCz11 21 19446180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGAGGCGCTCTAGGGGAAGGTTGATTATGCACGGGTCGGCCATGTTT[G/T]GAAGGGAATTCTGCTACGCTGTTGAGGCTGCGTTTGTCACGCCAGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030887 Nonsense 377 554 5 7
Genomic Location (Zv9):
Chromosome 21 (position 18308799)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19444288
GRCz11 21 19480924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATGRTTTTAWCTTATGGGATATGTGTGTRCTCTTGTAGATTGTATAT[A/T]AGGGGAATCCGTATGCTGAACACAATTCCACTGCCTATGCCACCTATGAR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
  • Skin pigmentation: A genomewide association study of skin pigmentation in a South Asian population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link