
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tm9sf4
- Ensembl ID:
- ENSDARG00000002536
- ZFIN ID:
- ZDB-GENE-040426-1575
- Description:
- transmembrane 9 superfamily protein member 4 [Source:RefSeq peptide;Acc:NP_956804]
- Human Orthologue:
- TM9SF4
- Human Description:
- transmembrane 9 superfamily protein member 4 [Source:HGNC Symbol;Acc:30797]
- Mouse Orthologue:
- Tm9sf4
- Mouse Description:
- transmembrane 9 superfamily protein member 4 Gene [Source:MGI Symbol;Acc:MGI:2139220]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43915 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1226 | Nonsense | Available for shipment | Available now |
sa13048 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43915
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006765 | Nonsense | 69 | 651 | 3 | 18 |
ENSDART00000011554 | Nonsense | 59 | 314 | 3 | 16 |
- Genomic Location (Zv9):
- Chromosome 23 (position 7628020)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 7620483 GRCz11 23 7554455 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGTTCCAGAACCCAGCTGCCCTACGAGTACTATTCACTTCCCTTCTGT[A/T]AGCCTGAAAATATTGTCTACAAGGCAGAAAACCTTGGTAAGTTGATTCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1226
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006765 | Nonsense | 474 | 651 | 14 | 18 |
ENSDART00000011554 | None | 314 | 12 | 16 |
- Genomic Location (Zv9):
- Chromosome 23 (position 7645977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 7638440 GRCz11 23 7572412 - KASP Assay ID:
- 554-1135.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGCTGGCTCTGTTGTGCATGTGGTTTGGTATCTCGTTGCCKCTCGTGTA[T/A]CTGGGCTATTACTTTGGTTTTCGCAAGCAGCCRTATGACAATCCAGTCCG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa13048
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006765 | Nonsense | 590 | 651 | 17 | 18 |
ENSDART00000011554 | None | 314 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 23 (position 7650259)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 7642722 GRCz11 23 7576694 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACCGGTGGTGGTGGAGGACKTTCCTTGTGTCTGGAGRATCTGCCTTCTA[C/A]GTCCTKATCTATGCCATTTTCTATTWCGTCAACAAGGTAACCTTCAGTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: