zgc:153911

Ensembl ID:
ENSDARG00000002509
ZFIN ID:
ZDB-GENE-061013-174
Description:
hypothetical protein LOC768172 [Source:RefSeq peptide;Acc:NP_001070783]
Human Orthologue:
CD276
Human Description:
CD276 molecule [Source:HGNC Symbol;Acc:19137]
Mouse Orthologue:
Cd276
Mouse Description:
CD276 antigen Gene [Source:MGI Symbol;Acc:MGI:2183926]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22348 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075299 Nonsense 208 288 3 4
Genomic Location (Zv9):
Chromosome 13 (position 36377048)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35849617
GRCz11 13 35975449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACATCGTGTCCAGCTGGATAAAACTCTCTGACGTCTCAAATTCATCTT[T/A]GACATTTATTCTGCACAACAAACCGCTGGGGCAAGACATCAGAAGAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link