itga10

Ensembl ID:
ENSDARG00000002507
ZFIN ID:
ZDB-GENE-100922-54
Human Orthologue:
ITGA10
Human Description:
integrin, alpha 10 [Source:HGNC Symbol;Acc:6135]
Mouse Orthologue:
Itga10
Mouse Description:
integrin, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:2153482]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36072 Nonsense Mutation detected in F1 DNA During 2018
sa22786 Essential Splice Site Available for shipment Available now
sa11418 Essential Splice Site Available for shipment Available now
sa45567 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15068 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Nonsense 411 1170 11 30
ENSDART00000139859 Nonsense 411 1174 12 31
Genomic Location (Zv9):
Chromosome 16 (position 16068017)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14412909
GRCz11 16 14303029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGGGAGGCATCCTGAAAGAAAGCAAAGAAGGGCAGCTTATGCCCCCA[C/T]GAGAGGCCTTTGAGAAAGAGTTCCCACTGGAGCTCAAGAATCATGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 595 1170 14 30
ENSDART00000139859 Essential Splice Site 595 1174 15 31
Genomic Location (Zv9):
Chromosome 16 (position 16064754)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14409646
GRCz11 16 14299766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACATCTACCATGGCGATGAATACTACATCATACCTCAGTATAAACAAG[T/G]AAATATAGCACCGTTTCATGGTTACAGACAGATCAATGGGTTAGTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 742 1170 17 30
ENSDART00000139859 Essential Splice Site 746 1174 18 31
Genomic Location (Zv9):
Chromosome 16 (position 16058355)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14403247
GRCz11 16 14293367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTCGTGTTGGAGAGACCAAGTGCTACATCTTGCCATTTCACGTTTTT[G/A]TAAGTCTTCAGAAAATCAATGAAGCAATGGAAATGTACATTTAGTCGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 886 1170 21 30
ENSDART00000139859 Essential Splice Site 890 1174 22 31
Genomic Location (Zv9):
Chromosome 16 (position 16055598)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14400490
GRCz11 16 14290610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCACTCGTGTAATGTCAGCTATCCTGTGTTTCGCTCTCAGTCAAAG[G/A]TAAGCTTCTGACAGTCAGATTCATCCAAACACTTACTAAGGTGTTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 1114 1170 28 30
ENSDART00000139859 Essential Splice Site 1118 1174 29 31
Genomic Location (Zv9):
Chromosome 16 (position 16050687)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14395579
GRCz11 16 14285699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGAGAGTCCAATCTGATTACAWTGGGAAATGCTGCCCTCTTGAGGGAG[G/A]TGAGAGAACTGRRACTTTAAATTAGATGACTGGTACCGGTCAAAGATRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link