zgc:171879

Ensembl ID:
ENSDARG00000002502
ZFIN ID:
ZDB-GENE-080204-21
Description:
synaptic vesicle membrane protein VAT-1 homolog-like [Source:RefSeq peptide;Acc:NP_001108032]
Human Orthologue:
VAT1L
Human Description:
vesicle amine transport protein 1 homolog (T. californica)-like [Source:HGNC Symbol;Acc:29315]
Mouse Orthologue:
Vat1l
Mouse Description:
vesicle amine transport protein 1 homolog-like (T. californica) Gene [Source:MGI Symbol;Acc:MGI:2142

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30339 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126956 Essential Splice Site 113 412 2 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3485 (position 102833)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 65086796
GRCz11 7 65310824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCTGGGATTGTGGAGTCTGTGGGAGAGAACACCAAAGGCTTCGAGG[T/C]ATGTTCATAAATGTTTTTTTGTTACGGTTATTTTCTTCCAACAATATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link