
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
noc3l
- Ensembl ID:
- ENSDARG00000002487
- ZFIN ID:
- ZDB-GENE-030131-9878
- Description:
- Nucleolar complex protein 3 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRN3]
- Human Orthologue:
- NOC3L
- Human Description:
- nucleolar complex associated 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24034]
- Mouse Orthologue:
- Noc3l
- Mouse Description:
- nucleolar complex associated 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1932610]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35204 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa41960 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9387 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa9316 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35204
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028043 | Essential Splice Site | 74 | 800 | 2 | 21 |
The following transcripts of ENSDARG00000002487 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 6370124)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 5381201 GRCz11 12 5416158 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTCCCATCAGACCCTCAAACCCCTGGAGCGCTACAAGAAGAGACCCGG[T/C]GAGCCAACATTGGTTTCTGGGTTGTTTTGCATGAGCTCAGTGCTGTTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41960
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028043 | Nonsense | 305 | 800 | 8 | 21 |
The following transcripts of ENSDARG00000002487 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 6376100)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 5375225 GRCz11 12 5410182 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGAGACGCTGCAGCTCAGAGAGTTTGAGGAGGGTCTGGTCAGCCAGTA[T/G]AAGTTTTACCTGGAGGAGCTGGAACAGACAGTCAAAGGTAGATCTCTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9387
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028043 | Essential Splice Site | 318 | 800 | 9 | 21 |
ENSDART00000028043 | Essential Splice Site | 318 | 800 | 9 | 21 |
The following transcripts of ENSDARG00000002487 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 6376208)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 5375117 GRCz11 12 5410074 - KASP Assay ID:
- 2260-4929.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTACYTGTTCATCCATTGTTTGTTTGTCTGACTGATCTGCTGTCGTTTCA[G/T]ACTGGAAGCAGAAGAAGGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9316
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028043 | Essential Splice Site | 318 | 800 | 9 | 21 |
ENSDART00000028043 | Essential Splice Site | 318 | 800 | 9 | 21 |
The following transcripts of ENSDARG00000002487 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 6376208)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 5375117 GRCz11 12 5410074 - KASP Assay ID:
- 2260-4929.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTACYTGTTCATCCATTGTTTGTTTGTCTGACTGATCTGCTGTCGTTTCA[G/T]ACTGGAAGCAGAAGAAGGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Esophageal cancer and gastric cancer: A shared susceptibility locus in PLCE1 at 10q23 for gastric adenocarcinoma and esophageal squamous cell carcinoma. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: