ugt5d1

Ensembl ID:
ENSDARG00000002394
ZFIN ID:
ZDB-GENE-091118-36
Description:
UDP glucuronosyltransferase 5 family, polypeptide D1 [Source:RefSeq peptide;Acc:NP_001170967]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21739 Nonsense Available for shipment Available now
sa21740 Nonsense Available for shipment Available now
sa41665 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003987 Nonsense 103 532 2 2
ENSDART00000140308 Nonsense 103 497 2 2
Genomic Location (Zv9):
Chromosome 10 (position 26361991)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25765848
GRCz11 10 25727561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGAAAACTTTTTTGAAGATTATTTATCGAAAGCGATGGAGATAGAG[C/T]GAGGCGAAGGTTCTGGACTTGCATTCTTGAAACTCCAATATGATCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003987 Nonsense 427 532 2 2
ENSDART00000140308 Nonsense 427 497 2 2
Genomic Location (Zv9):
Chromosome 10 (position 26362963)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25766820
GRCz11 10 25728533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGGGAAAGGAGCGGGTAAGATACTTAAGCTGTCAGAACTCAATGCC[G/T]AAGCTTTCGAACAAGCCCTTCAGGAGTTGCTCAATGACGGCTCCTACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003987 Nonsense 434 532 2 2
ENSDART00000140308 Nonsense 434 497 2 2
Genomic Location (Zv9):
Chromosome 10 (position 26362984)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25766841
GRCz11 10 25728554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATACTTAAGCTGTCAGAACTCAATGCCGAAGCTTTCGAACAAGCCCTT[C/T]AGGAGTTGCTCAATGACGGCTCCTACAAGAGGAACATGCAGACACTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link