
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dlc
- Ensembl ID:
- ENSDARG00000002336
- ZFIN ID:
- ZDB-GENE-000125-4
- Description:
- Delta-like protein C [Source:UniProtKB/Swiss-Prot;Acc:Q9IAT6]
- Human Orthologue:
- DLL3
- Human Description:
- delta-like 3 (Drosophila) [Source:HGNC Symbol;Acc:2909]
- Mouse Orthologue:
- Dll3
- Mouse Description:
- delta-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1096877]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35867 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa42530 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35867
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018514 | Nonsense | 415 | 664 | 7 | 9 |
The following transcripts of ENSDARG00000002336 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 19427362)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 20529988 GRCz11 15 20465720 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGATTTGGGCAACAAAGCGACGTGCCGTTGCCGGCCCGGGTTCACAGGCT[C/A]ACGTTGTGAAACAAACATTGACGACTGCTCAAGCAACCCCTGTCAAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42530
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018514 | Nonsense | 548 | 664 | 7 | 9 |
The following transcripts of ENSDARG00000002336 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 19426964)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 20529590 GRCz11 15 20465322 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTCCTGCGACAGATGCGTCAGAACCACAAAGCCAGCTCAACCACAGTT[C/T]GAAACAACCTGGATTCTGTCAATAATCGCATTTCTTTGAGCCCAACCTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: