
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
me3
- Ensembl ID:
- ENSDARG00000002305
- ZFIN ID:
- ZDB-GENE-041111-294
- Description:
- NADP-dependent malic enzyme, mitochondrial [Source:RefSeq peptide;Acc:NP_001082825]
- Human Orthologue:
- ME3
- Human Description:
- malic enzyme 3, NADP(+)-dependent, mitochondrial [Source:HGNC Symbol;Acc:6985]
- Mouse Orthologue:
- Me3
- Mouse Description:
- malic enzyme 3, NADP(+)-dependent, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1916679]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1196 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1196
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012385 | Essential Splice Site | 180 | 603 | 5 | 15 |
- Genomic Location (Zv9):
- Chromosome 9 (position 35229363)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 34448874 GRCz11 9 34258059 - KASP Assay ID:
- 554-1105.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGGGCATATYGCCACTATGCTGAACTCATGGCCAGAGGAGGAYATTAAGG[T/A]ATGTGCTAAAAGATAATGTTGTTATTTTGGTGCCAKCAAATGGGAGTTTC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: