arsh

Ensembl ID:
ENSDARG00000002299
ZFIN ID:
ZDB-GENE-081104-120
Human Orthologues:
ARSD, ARSE, ARSF, ARSH
Human Descriptions:
arylsulfatase D [Source:HGNC Symbol;Acc:717]
arylsulfatase E (chondrodysplasia punctata 1) [Source:HGNC Symbol;Acc:719]
arylsulfatase F [Source:HGNC Symbol;Acc:721]
arylsulfatase family, member H [Source:HGNC Symbol;Acc:32488]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41563 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032992 Nonsense 98 587 3 11
ENSDART00000134212   None 479 None 7
Genomic Location (Zv9):
Chromosome 9 (position 57806389)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56237932
GRCz11 9 55588473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGGCCGCTCCACTCTGCACACCCAGCAGAACTGCCTTCATGACGGGA[C/T]GATACCCTCTGCGCGCCGGTCAGAGAACAAACATCGTCTGCCTCACATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association study of body height in African Americans: the Women's Health Initiative SNP Health Association Resource (SHARe). (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link