
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-21p1.3
- Ensembl ID:
- ENSDARG00000002295
- ZFIN ID:
- ZDB-GENE-081105-162
- Description:
- Novel collagen protein [Source:UniProtKB/TrEMBL;Acc:B0UYF9]
- Human Orthologues:
- COL24A1, COL27A1
- Human Descriptions:
- collagen, type XXIV, alpha 1 [Source:HGNC Symbol;Acc:20821]
- collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
- Mouse Orthologues:
- Col24a1, Col27a1
- Mouse Descriptions:
- collagen, type XXIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1918605]
- collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15248 | Nonsense | Available for shipment | Available now |
sa21230 | Nonsense | Available for shipment | Available now |
sa41153 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9363 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa21231 | Essential Splice Site | Available for shipment | Available now |
sa45314 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa45315 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa640 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa15248
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | None | 190 | None | 7 | |
ENSDART00000125681 | None | 185 | None | 8 | |
ENSDART00000128489 | Nonsense | 13 | 103 | 1 | 5 |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Nonsense | 145 | 1125 | 9 | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15383158)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14828502 GRCz11 8 14866207 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTATTAAATCTCTWCAGGGAAAACCAGGAGGTGATGGACCACCAGGTCAA[A/T]AAGGAGAGYGTGTATGTGCATCCAATATTATWTTCYGAAAACTTGTAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21230
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | None | 190 | None | 7 | |
ENSDART00000125681 | None | 185 | None | 8 | |
ENSDART00000128489 | Nonsense | 44 | 103 | 3 | 5 |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Nonsense | 176 | 1125 | 11 | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15383480)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14828824 GRCz11 8 14866529 - KASP Assay ID:
- 2260-0307.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGCCACTTTTTTTTGTTTTAGGGTGCCATTGGAAAACCAGGAAATCTT[G/T]GACCCTCAGGTGATCCAGTAAGATTACCTCAAACAGCTCCTTAATATGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41153
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | Nonsense | 60 | 190 | 2 | 7 |
ENSDART00000125681 | None | 185 | None | 8 | |
ENSDART00000128489 | None | 103 | None | 5 | |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Nonsense | 475 | 1125 | 26 | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15389051)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14834395 GRCz11 8 14872100 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTCAGGGTAAAGATGGACCTCTTGGACCCATCGGGCCTGAAGGAGAC[A/T]AAGGCAATAAAGTAGGCTGTATTTTTTTCTTTTCTTATCTTCATTTTTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9363
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | Essential Splice Site | 154 | 190 | None | 7 |
ENSDART00000125681 | None | 185 | None | 8 | |
ENSDART00000128489 | None | 103 | None | 5 | |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Essential Splice Site | 551 | 1125 | None | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15392453)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14837797 GRCz11 8 14875502 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTTGCAYATTCTTGTTGNTTTTATGTTTTYTGTGGGTTTGTGAATATTT[A/C]GGGTCATCCAGGTGTAAGAGGTCAATCCGGATTAGTAGGACAGTACGGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21231
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | Essential Splice Site | 154 | 190 | 7 | 7 |
ENSDART00000125681 | None | 185 | None | 8 | |
ENSDART00000128489 | None | 103 | None | 5 | |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Essential Splice Site | 551 | 1125 | 30 | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15392454)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14837798 GRCz11 8 14875503 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTGCACATTCTTGTTGTTTTATGTTTTCTGTGGGTTTGTGAATATTTA[G/T]GGTCATCCAGGTGTAAGAGGTCAATCCGGATTAGTAGGACAGTACGGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45314
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | None | 190 | None | 7 | |
ENSDART00000125681 | Essential Splice Site | 54 | 185 | 3 | 8 |
ENSDART00000128489 | None | 103 | None | 5 | |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Essential Splice Site | 658 | 1125 | 34 | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15393146)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14838490 GRCz11 8 14876195 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATAGGTCTAATTGGGAAGAAAGGAGAGCCTGGAAAACAAGGCAGAGTG[G/A]TGAGATACACTTTACATCCTCATTTATTTCCAATACAAACAACAAAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45315
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | None | 190 | None | 7 | |
ENSDART00000125681 | Nonsense | 177 | 185 | 8 | 8 |
ENSDART00000128489 | None | 103 | None | 5 | |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | None | 1125 | None | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15394746)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14840090 GRCz11 8 14877795 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGCTGTAAGTAAGCTTGTTTTGTACAGGCATGAAAAATGTGTCAGTTA[T/A]AAAATATTGTTATTATTTTTGGCATAGTTTCAATACTCATTCACAGGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa640
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098151 | None | 190 | None | 7 | |
ENSDART00000125681 | None | 185 | None | 8 | |
ENSDART00000128489 | None | 103 | None | 5 | |
ENSDART00000129712 | None | 114 | None | 6 | |
ENSDART00000134775 | Nonsense | 1087 | 1125 | 52 | 52 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15400525)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 14845869 GRCz11 8 14883574 - KASP Assay ID:
- 554-0549.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTTGCATTATATTGCAGGTAACTGCACAGGTGAGGGTTCATGGGAGTT[C/A]AGAGCTCCACAGGGGAGACATGCAGCTACTTCCTATCAGAGATGTTTTTG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Many sequence variants affecting diversity of adult human height. (View Study)
- Tourette syndrome: Genome-wide association study of Tourette's syndrome. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: