ENSDARG00000002295 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

si:dkey-21p1.3

Ensembl ID:: ENSDARG00000002295
ZFIN ID:: ZDB-GENE-081105-162
Description:: Novel collagen protein [Source:UniProtKB/TrEMBL;Acc:B0UYF9]
Human Orthologues:: COL24A1, COL27A1
Human Descriptions:: collagen, type XXIV, alpha 1 [Source:HGNC Symbol;Acc:20821]; collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
Mouse Orthologues:: Col24a1, Col27a1
Mouse Descriptions:: collagen, type XXIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1918605]; collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]

Alleles

There are 8 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa15248	Nonsense	Available for shipment	Available now
sa21230	Nonsense	Available for shipment	Available now
sa41153	Nonsense	Mutation detected in F1 DNA	During 2018
sa9363	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa21231	Essential Splice Site	Available for shipment	Available now
sa45314	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa45315	Nonsense	Mutation detected in F1 DNA	During 2018
sa640	Nonsense	F2 line generated	During 2018

Mutation Details

Allele Name:: sa15248
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151		None	190	None	7
ENSDART00000125681		None	185	None	8
ENSDART00000128489	Nonsense	13	103	1	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Nonsense	145	1125	9	52

Genomic Location (Zv9):

Chromosome 8 (position 15383158)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14828502
GRCz11	8	14866207

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TTATTAAATCTCTWCAGGGAAAACCAGGAGGTGATGGACCACCAGGTCAA[A/T]AAGGAGAGYGTGTATGTGCATCCAATATTATWTTCYGAAAACTTGTAAAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21230
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: G > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151		None	190	None	7
ENSDART00000125681		None	185	None	8
ENSDART00000128489	Nonsense	44	103	3	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Nonsense	176	1125	11	52

Genomic Location (Zv9):

Chromosome 8 (position 15383480)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14828824
GRCz11	8	14866529

KASP Assay ID:

2260-0307.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGAGCCACTTTTTTTTGTTTTAGGGTGCCATTGGAAAACCAGGAAATCTT[G/T]GACCCTCAGGTGATCCAGTAAGATTACCTCAAACAGCTCCTTAATATGTT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa41153
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151	Nonsense	60	190	2	7
ENSDART00000125681		None	185	None	8
ENSDART00000128489		None	103	None	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Nonsense	475	1125	26	52

Genomic Location (Zv9):

Chromosome 8 (position 15389051)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14834395
GRCz11	8	14872100

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCTTTCAGGGTAAAGATGGACCTCTTGGACCCATCGGGCCTGAAGGAGAC[A/T]AAGGCAATAAAGTAGGCTGTATTTTTTTCTTTTCTTATCTTCATTTTTGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa9363
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151	Essential Splice Site	154	190	None	7
ENSDART00000125681		None	185	None	8
ENSDART00000128489		None	103	None	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Essential Splice Site	551	1125	None	52

Genomic Location (Zv9):

Chromosome 8 (position 15392453)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14837797
GRCz11	8	14875502

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GTGTTGCAYATTCTTGTTGNTTTTATGTTTTYTGTGGGTTTGTGAATATTT[A/C]GGGTCATCCAGGTGTAAGAGGTCAATCCGGATTAGTAGGACAGTACGGTC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21231
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151	Essential Splice Site	154	190	7	7
ENSDART00000125681		None	185	None	8
ENSDART00000128489		None	103	None	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Essential Splice Site	551	1125	30	52

Genomic Location (Zv9):

Chromosome 8 (position 15392454)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14837798
GRCz11	8	14875503

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGTTGCACATTCTTGTTGTTTTATGTTTTCTGTGGGTTTGTGAATATTTA[G/T]GGTCATCCAGGTGTAAGAGGTCAATCCGGATTAGTAGGACAGTACGGTCC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa45314
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151		None	190	None	7
ENSDART00000125681	Essential Splice Site	54	185	3	8
ENSDART00000128489		None	103	None	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Essential Splice Site	658	1125	34	52

Genomic Location (Zv9):

Chromosome 8 (position 15393146)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14838490
GRCz11	8	14876195

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CAATAGGTCTAATTGGGAAGAAAGGAGAGCCTGGAAAACAAGGCAGAGTG[G/A]TGAGATACACTTTACATCCTCATTTATTTCCAATACAAACAACAAAACAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa45315
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151		None	190	None	7
ENSDART00000125681	Nonsense	177	185	8	8
ENSDART00000128489		None	103	None	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775		None	1125	None	52

Genomic Location (Zv9):

Chromosome 8 (position 15394746)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14840090
GRCz11	8	14877795

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGTGCTGTAAGTAAGCTTGTTTTGTACAGGCATGAAAAATGTGTCAGTTA[T/A]AAAATATTGTTATTATTTTTGGCATAGTTTCAATACTCATTCACAGGGAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa640
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098151		None	190	None	7
ENSDART00000125681		None	185	None	8
ENSDART00000128489		None	103	None	5
ENSDART00000129712		None	114	None	6
ENSDART00000134775	Nonsense	1087	1125	52	52

Genomic Location (Zv9):

Chromosome 8 (position 15400525)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	14845869
GRCz11	8	14883574

KASP Assay ID:

554-0549.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CACTTGCATTATATTGCAGGTAACTGCACAGGTGAGGGTTCATGGGAGTT[C/A]AGAGCTCCACAGGGGAGACATGCAGCTACTTCCTATCAGAGATGTTTTTG

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Height: Many sequence variants affecting diversity of adult human height. (View Study)
Tourette syndrome: Genome-wide association study of Tourette's syndrome. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for COL27A1

OMIM information for COL24A1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: