zfand5b

Ensembl ID:
ENSDARG00000002271
ZFIN ID:
ZDB-GENE-040426-875
Description:
zinc finger, AN1-type domain 5b [Source:RefSeq peptide;Acc:NP_957243]
Human Orthologue:
ZFAND5
Human Description:
zinc finger, AN1-type domain 5 [Source:HGNC Symbol;Acc:13008]
Mouse Orthologue:
Zfand5
Mouse Description:
zinc finger, AN1-type domain 5 Gene [Source:MGI Symbol;Acc:MGI:1278334]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44721 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024450 Nonsense 98 212 3 5

The following transcripts of ENSDARG00000002271 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15637292)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15650599
GRCz11 10 15608718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGCGCTGAGTCGCCCTGCGCAGCCGCCGCCGCTGCCCTTCCGGTTACA[C/T]AACAGATGACTGAGATGAGCATTTCCTGTGAAGATGATGCCGCCTCGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link