KCNA2 (2 of 2)

Ensembl ID:
ENSDARG00000002241
Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 [Source:HGNC Symbol;Acc:6220]
Human Orthologue:
KCNA2
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 [Source:HGNC Symbol;Acc:6220]
Mouse Orthologue:
Kcna2
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20814 Nonsense Mutation detected in F1 DNA During 2018
sa44645 Nonsense Mutation detected in F1 DNA During 2018
sa2280 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa20814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027398 Nonsense 91 493 1 2
Genomic Location (Zv9):
Chromosome 6 (position 49358297)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49414373
GRCz11 6 49413026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTTTTGACAGAAACCGCCCCAGCTTTGACGCCATTCTCTATTACTA[T/A]CAATCAGGCGGAAGGTTGCGGAGACCAGTCAATGTCACATTGGATGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027398 Nonsense 113 493 1 2
Genomic Location (Zv9):
Chromosome 6 (position 49358361)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49414437
GRCz11 6 49413090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGCGGAGACCAGTCAATGTCACATTGGATGTGTTCTCAGAGGAGATT[C/T]GATTTTATGAGCTCGGAGACGAAGCCATTGAGATTTTCAGGGAGGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2280
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027398 Nonsense 154 493 1 2
Genomic Location (Zv9):
Chromosome 6 (position 49358486)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49414562
GRCz11 6 49413215
KASP Assay ID:
554-2435.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGCCTGACAATGAGTTTCAGAAGCAGGTCTGGTTGCTGTTCGAGTA[T/A]CCAGAAAGTTCAGGGCCAGCCAGGATTATAGCAATCRTATCTGTAATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link