stk25a

Ensembl ID:
ENSDARG00000002210
ZFIN ID:
ZDB-GENE-041010-92
Description:
serine/threonine kinase 25a [Source:RefSeq peptide;Acc:NP_001005925]
Human Orthologue:
STK25
Human Description:
serine/threonine kinase 25 [Source:HGNC Symbol;Acc:11404]
Mouse Orthologue:
Stk25
Mouse Description:
serine/threonine kinase 25 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1891699]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127418 Nonsense 85 424 2 11
Genomic Location (Zv9):
Chromosome 6 (position 26763584)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27064795
GRCz11 6 27055356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTCAGCCAGTGCGACAGCCCTTATGTCACCAAATACTATGGATCCTA[T/A]CTGACGGTTKGTGGAWATTTMATTATTTTGGCAACTGCTTTTAAAATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link