
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rhd
- Ensembl ID:
- ENSDARG00000002194
- ZFIN ID:
- ZDB-GENE-051213-1
- Description:
- Rh blood group, D antigen [Source:RefSeq peptide;Acc:NP_001019990]
- Human Orthologues:
- RHCE, RHD
- Human Descriptions:
- Rh blood group, CcEe antigens [Source:HGNC Symbol;Acc:10008]
- Rh blood group, D antigen [Source:HGNC Symbol;Acc:10009]
- Mouse Orthologue:
- Rhd
- Mouse Description:
- Rh blood group, D antigen Gene [Source:MGI Symbol;Acc:MGI:1202882]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42292 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42292
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020663 | Essential Splice Site | 53 | 423 | None | 10 |
The following transcripts of ENSDARG00000002194 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 46143014)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 45385922 GRCz11 13 45522826 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAGAGTACAGAAGGTCTGAAAGTGAGCCCTTCGTCCACTCATATGCAGG[T/C]CAGTAAGTCTGAATTACAGTAAGGATTTGTTATGAATCTTTTAAAACCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: