aspn

Ensembl ID:
ENSDARG00000002192
ZFIN ID:
ZDB-GENE-041105-7
Description:
asporin [Source:RefSeq peptide;Acc:NP_571788]
Human Orthologue:
ASPN
Human Description:
asporin [Source:HGNC Symbol;Acc:14872]
Mouse Orthologue:
Aspn
Mouse Description:
asporin Gene [Source:MGI Symbol;Acc:MGI:1913945]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37439 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064798 Essential Splice Site None 370 2 8
ENSDART00000143164   None 161 None 4
Genomic Location (Zv9):
Chromosome 22 (position 10596641)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10456809
GRCz11 22 10486491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTAACGCAAAAATGCCGAACTTGACATCTACTTATGTTCATGTTGAC[A/T]GGACTAAACCCCCACCATGAAGGTACTTTTACTACTCGCCCTACTAACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link