zgc:55347

Ensembl ID:
ENSDARG00000002184
ZFIN ID:
ZDB-GENE-040426-2928
Description:
immunoglobulin-binding protein 1 [Source:RefSeq peptide;Acc:NP_998687]
Human Orthologues:
AC011195.1, IGBP1
Human Descriptions:
HCG1642624, isoform CRA_aUncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JKU5]
immunoglobulin (CD79A) binding protein 1 [Source:HGNC Symbol;Acc:5461]
Mouse Orthologues:
Igbp1, Igbp1b
Mouse Descriptions:
immunoglobulin (CD79A) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346500]
immunoglobulin (CD79A) binding protein 1b Gene [Source:MGI Symbol;Acc:MGI:1354380]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20473 Nonsense Available for shipment Available now
sa14903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006899 Nonsense 133 355 2 6

The following transcripts of ENSDARG00000002184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38132111)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35931795
GRCz11 5 36531948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTTTACTTCATAGACTTCCTCAAGAGGTGCAAGGACTATGACATATG[T/A]AGTTTTCAGCTGCCCAAAGACTGCGAGAACACAGCAGACACTCCAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006899 Nonsense 172 355 2 6

The following transcripts of ENSDARG00000002184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38132226)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35931910
GRCz11 5 36532063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTCCCAATGCCAATGTCTCAGCCAGACCTCATCGCCATGGYAACA[C/T]AGAGACAAGCCAAAATTGAGAGGTGGGTTGGTAGRATTGGGTAGCATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link