stam

Ensembl ID:
ENSDARG00000002127
ZFIN ID:
ZDB-GENE-031118-123
Description:
signal transducing adapter molecule 1 [Source:RefSeq peptide;Acc:NP_956414]
Human Orthologue:
STAM
Human Description:
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 [Source:HGNC Symbol;Acc:11357]
Mouse Orthologue:
Stam
Mouse Description:
signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11405 Essential Splice Site Available for shipment Available now
sa14697 Essential Splice Site Available for shipment Available now
sa31282 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026966 Essential Splice Site 13 509 1 16
ENSDART00000141170 Essential Splice Site 13 516 1 14

The following transcripts of ENSDARG00000002127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31153464)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31454524
GRCz11 2 31437742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCGGCCATGCCTCTCTTCACGACAAATCCATTTGATCAAGATGTTG[G/T]TAAGTTTGAGCTGTCATGCATTTAGCGGTCGAGCTAACGGAGCTCWGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026966 Essential Splice Site 14 509 1 16
ENSDART00000141170 Essential Splice Site 14 516 1 14

The following transcripts of ENSDARG00000002127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31153465)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31454525
GRCz11 2 31437743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCGGCCATGCCTCTCTTCACGACAAATCCATTTGATCAAGATGTTGK[T/A]AAGTTTGAGCTGTCATGCATTTAGCGGTCGAGCTAACGGAGCTCWGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026966 Nonsense 48 509 3 16
ENSDART00000141170 Nonsense 48 516 3 14

The following transcripts of ENSDARG00000002127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31158651)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31459711
GRCz11 2 31442929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGGTAAAATATTATTTGTTGTCTTCTGAAGGCCTAAAGAATGCCTG[C/T]GATCTATAATGAGGAGAGTGAATCACAAGGATCCCCATGTTGCCATGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link