zgc:56533

Ensembl ID:
ENSDARG00000002002
ZFIN ID:
ZDB-GENE-040426-1067
Description:
hypothetical protein LOC394045 [Source:RefSeq peptide;Acc:NP_957364]
Human Orthologue:
LMCD1
Human Description:
LIM and cysteine-rich domains 1 [Source:HGNC Symbol;Acc:6633]
Mouse Orthologue:
Lmcd1
Mouse Description:
LIM and cysteine-rich domains 1 Gene [Source:MGI Symbol;Acc:MGI:1353635]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39388 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9066 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19308 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008913 Essential Splice Site None 162 2 6
ENSDART00000124991   None 342 None 5
Genomic Location (Zv9):
Chromosome 22 (position 42143130)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39110635
GRCz11 22 39097219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGAGCTGCACCTCACCTCACCATAACGCGGAATAAACTCCAGAAGG[T/C]AAGTGATGTGTTAGCATTTTCAACTATTTACATGAACAGATGCTACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
Genomic Location (Zv9):
Chromosome 22 (position 42146201)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39113706
GRCz11 22 39100290
KASP Assay ID:
554-6174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGACATGTAAAGGGATCTGCCCTGGATTCCAGCCACATTCCTGGAG[G/A]TAATTTATTCTCTTGACTGAAAATATAAAAATGAGAAGANNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
Genomic Location (Zv9):
Chromosome 22 (position 42146201)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39113706
GRCz11 22 39100290
KASP Assay ID:
554-6174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGACATGTAAAGGGATCTGCCCTGGATTCCAGCCACATTCCTGGAG[G/A]TAATTTATTCTCTTGACTGAAAATATAAAAATGAGAAGATGTGTGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link