stxbp1

Ensembl ID:
ENSDARG00000001994
ZFIN ID:
ZDB-GENE-050626-106
Description:
syntaxin-binding protein 1 [Source:RefSeq peptide;Acc:NP_001020353]
Human Orthologue:
STXBP1
Human Description:
syntaxin binding protein 1 [Source:HGNC Symbol;Acc:11444]
Mouse Orthologue:
Stxbp1
Mouse Description:
syntaxin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:107363]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43599 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23888 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015629 Essential Splice Site 57 591 4 19
ENSDART00000148199   None 126 None 5
Genomic Location (Zv9):
Chromosome 21 (position 12089549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13790723
GRCz11 21 13887452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAACATGTTTTCCTGTGACTGACCTGTTGTTTGTACCTTCATCTCTGC[A/T]GTTGTTGAAGACATCATGAAACGGAGAGAACCTCTTCCCTCACTGGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015629 Nonsense 379 591 14 19
ENSDART00000148199   None 126 None 5
Genomic Location (Zv9):
Chromosome 21 (position 12108230)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13809404
GRCz11 21 13906133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTTCTCTCCAACACCTGGCAGGATCTCGCAATGGGAACAGATGCT[G/T]AGGGTGAGAAGATTAAAGACCCCATGAGGGCCATCGTGCCAATCTTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link