txlng

Ensembl ID:
ENSDARG00000001969
ZFIN ID:
ZDB-GENE-060616-122
Description:
gamma-taxilin [Source:RefSeq peptide;Acc:NP_001037776]
Human Orthologues:
CYorf15A, CYorf15B, TXLNG
Human Descriptions:
chromosome Y open reading frame 15A [Source:HGNC Symbol;Acc:18473]
chromosome Y open reading frame 15B [Source:HGNC Symbol;Acc:18577]
taxilin gamma [Source:HGNC Symbol;Acc:18578]
Mouse Orthologues:
Gm8258, Txlng
Mouse Descriptions:
predicted gene 8258 Pseudogene [Source:MGI Symbol;Acc:MGI:3644429]
taxilin gamma Gene [Source:MGI Symbol;Acc:MGI:3590652]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41795 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103449 Nonsense 362 468 9 9
ENSDART00000104143 Nonsense 383 489 9 9
ENSDART00000121539   None 355 None 8
ENSDART00000124936 Nonsense 383 489 9 9
Genomic Location (Zv9):
Chromosome 11 (position 12843581)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12727990
GRCz11 11 12785649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATTAGTTTTAAAGTCCCTGTTTTCATTTGTCTTGAAGAAAACAGTG[C/T]GAGACAAAAATTACAAGGCCCTCCAAGGTAAACTGGATCGTCTGGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link