
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-153l6.5
- Ensembl ID:
- ENSDARG00000001913
- ZFIN ID:
- ZDB-GENE-070705-48
- Description:
- LOC559824 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLW3]
- Human Orthologue:
- PALMD
- Human Description:
- palmdelphin [Source:HGNC Symbol;Acc:15846]
- Mouse Orthologue:
- Palmd
- Mouse Description:
- palmdelphin Gene [Source:MGI Symbol;Acc:MGI:2148896]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15796 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15796
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006817 | Nonsense | 240 | 462 | 7 | 7 |
ENSDART00000137848 | Nonsense | 237 | 459 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 18932119)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 20760850 GRCz11 2 20418822 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCCACCAGCCTGGAGCCAACGGAGTGGATGAACTYAGTCCTGTGGAGGTC[G/T]AAGAGCTGCTCAGACAGGCCTCAGGAAAGAAGAAATTGGGCAATCAAGTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cardiac structure and function: Genetic variants associated with cardiac structure and function: a meta-analysis and replication of genome-wide association data. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: