si:dkey-247m21.3

Ensembl ID:
ENSDARG00000001906
ZFIN ID:
ZDB-GENE-091204-249
Human Orthologue:
HTR4
Human Description:
5-hydroxytryptamine (serotonin) receptor 4 [Source:HGNC Symbol;Acc:5299]
Mouse Orthologue:
Htr4
Mouse Description:
5 hydroxytryptamine (serotonin) receptor 4 Gene [Source:MGI Symbol;Acc:MGI:109246]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23906 Nonsense Available for shipment Available now
sa23907 Nonsense Available for shipment Available now
sa12008 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025860 Nonsense 19 360 2 5
ENSDART00000132853   None 151 None 4
Genomic Location (Zv9):
Chromosome 21 (position 19065080)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20200569
GRCz11 21 20237205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTTGTCAACAGTTCAGTCGATGAAGTTGTGTCTAAACACACTT[C/A]GAGGATAACGCTGTCTATTGTCCTGGTGACCATCATTATAATGACCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025860 Nonsense 87 360 3 5
ENSDART00000132853 Nonsense 49 151 2 4
Genomic Location (Zv9):
Chromosome 21 (position 19066925)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20202414
GRCz11 21 20239050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTGGTTGTGATGCCACTGGCAGCCATAGAGTTAACCACAGGGAAGTG[G/A]AATTATGGAGAGACGTTCTGCCTGGTGCGAACCTCACTGGATGTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025860 Nonsense 207 360 5 5
ENSDART00000132853   None 151 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19072888)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20208377
GRCz11 21 20245013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATATGCYCTGGTGTGTTCRGCTGTGGCTTTCTATGTGCCTCTAGTTT[T/A]AAWGGTTCTGGCCTATCAGCGGATCTATGTMACCGCCATGGGACAYGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link