zgc:110815

Ensembl ID:
ENSDARG00000001897
ZFIN ID:
ZDB-GENE-050327-52
Description:
lysosomal alpha-mannosidase [Source:RefSeq peptide;Acc:NP_001014354]
Human Orthologue:
MAN2B1
Human Description:
mannosidase, alpha, class 2B, member 1 [Source:HGNC Symbol;Acc:6826]
Mouse Orthologue:
Man2b1
Mouse Description:
mannosidase 2, alpha B1 Gene [Source:MGI Symbol;Acc:MGI:107286]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31840 Essential Splice Site Available for shipment Available now
sa41874 Nonsense Mutation detected in F1 DNA During 2018
sa12135 Essential Splice Site Available for shipment Available now
sa7293 Nonsense Mutation detected in F1 DNA During 2018
sa4425 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa31840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004780 Essential Splice Site 69 982 3 22
ENSDART00000141062 Essential Splice Site 69 259 3 6
Genomic Location (Zv9):
Chromosome 11 (position 32100177)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31012042
GRCz11 11 31275102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCTCCAGTTTTTGATTCCAGTCATTGAGTTTTTTTTTTTTTTTCCTC[A/T]GACCGAAATAACATCCAGCATGCAGGTGTTCAGTATATTCTGGACTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004780 Nonsense 111 982 3 22
ENSDART00000141062 Nonsense 111 259 3 6
Genomic Location (Zv9):
Chromosome 11 (position 32100050)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31011915
GRCz11 11 31274975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGACGCTTTATCTATGTTGAGACGGCCTTCTTTTACCGCTGGTGGAGA[C/T]AGCAGAACCAGAACACACGCCGCATTGTGACCCAGCTGGTCAATGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004780 Essential Splice Site 236 982 5 22
ENSDART00000141062 Essential Splice Site 236 259 5 6
Genomic Location (Zv9):
Chromosome 11 (position 32098261)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31010126
GRCz11 11 31273186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGGCCAGTGAGAGCCTGACTCCACCTATWGCCGATCTCTTCACAGG[T/A]ACTTTTATGCAAACCTGCAKTTTCTTGAGCTRATGCRTAATCTAATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004780 Nonsense 310 982 7 22
ENSDART00000141062   None 259 None 6
Genomic Location (Zv9):
Chromosome 11 (position 32096618)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31008483
GRCz11 11 31271543
KASP Assay ID:
554-4525.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGACCATGGGTTCAGACTTCCAGTATGAAAATGCCAATCTGTGGTA[T/A]AAAAATATGGATAAGCTGATCAAGTATGTAAATGCACTGCAAGCCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4425
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004780 Essential Splice Site 704 982 15 22
ENSDART00000141062   None 259 None 6
Genomic Location (Zv9):
Chromosome 11 (position 32089602)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31001467
GRCz11 11 31264527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCAGGGAACTGGAGCTGGAGTGGACTGTAGGACCCGTGCCTGTTGAG[T/A]AAGTCCACRCACACACACACACGCACGCACNNNNNNNNNNNNNNGCACGCATGCAAGGGCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link