si:dkey-239i15.3

Ensembl ID:
ENSDARG00000001890
ZFIN IDs:
ZDB-GENE-030131-2638, ZDB-GENE-070424-229
Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog B [Source:RefSeq peptide;Acc:NP_955
Human Orthologue:
STT3B
Human Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) [Source:HGNC Symbo
Mouse Orthologue:
Stt3b
Mouse Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) Gene [Source:MGI S

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42789 Nonsense Mutation detected in F1 DNA During 2018
sa22917 Nonsense Available for shipment Available now
sa5896 Nonsense Mutation detected in F1 DNA During 2018
sa22916 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041980 Nonsense 204 244 3 5
ENSDART00000102525 Nonsense 204 805 3 16
Genomic Location (Zv9):
Chromosome 16 (position 42101910)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39485360
GRCz11 16 39435392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGTACCAGGCTACATTTCCCGCTCTGTGGCTGGCTCTTTTGACAAC[G/T]AGGGCATTGCCATTTTTGCCTTGCAGTTTACTTACTACTTATGGGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041980   None 244 None 5
ENSDART00000102525 Nonsense 320 805 7 16
Genomic Location (Zv9):
Chromosome 16 (position 42080038)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39463488
GRCz11 16 39413520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGCAGGTGTATTCGCATTGCTTCAGGCTTACGCTTTCCTGCAGTA[T/A]CTGAAGGACAGACTCACCAGACAAGAGTTCCAGACACTGTTCTTTCTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041980   None 244 None 5
ENSDART00000102525 Nonsense 469 805 10 16
Genomic Location (Zv9):
Chromosome 16 (position 42065557)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39449007
GRCz11 16 39399039
KASP Assay ID:
554-3865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGGCCATCGCCTTCTCCAGCGTCTTCGAGCACTACCTAGGGGACGATT[T/A]GAAGCGTGAAAACCCACCGGCTGAGGACAGCAGTGATGAGGATGACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041980 Splice Site None 244 None 5
ENSDART00000102525 Nonsense 791 805 16 16
Genomic Location (Zv9):
Chromosome 16 (position 42053617)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39437067
GRCz11 16 39387099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCGTTGGTTCACAGACAGCCAAGAGGAAGCGGGGGCACATCAAAAAC[A/T]AGCTGGCTCTGAAAAAAGGCAAGAAACTGAACAAGAAGTCTGTTTAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link