
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
aff4
- Ensembl ID:
- ENSDARG00000001857
- ZFIN ID:
- ZDB-GENE-100910-5
- Description:
- Zcchc10 protein [Source:UniProtKB/TrEMBL;Acc:A1L2C5]
- Human Orthologue:
- AFF4
- Human Description:
- AF4/FMR2 family, member 4 [Source:HGNC Symbol;Acc:17869]
- Mouse Orthologue:
- Aff4
- Mouse Description:
- AF4/FMR2 family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2136171]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10553 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10553
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000042840 | Nonsense | 429 | 582 | 9 | 10 |
ENSDART00000126998 | Nonsense | 429 | 587 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 21 (position 41632950)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 43231996 GRCz11 21 43227172 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAGCGAGAGCGAGAGCAGCTCCACCGACAGCGAGACCACCGAACCGCCW[C/T]GAGCTGCGACCCCCGAGGTAWATACATCGTATACTAATACTYATTTAAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: