zgc:112982

Ensembl ID:
ENSDARG00000001829
ZFIN ID:
ZDB-GENE-050306-55
Description:
hypothetical protein LOC503771 [Source:RefSeq peptide;Acc:NP_001013367]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24506 Nonsense Available for shipment Available now
sa45013 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024606   None 271 None 9
ENSDART00000111096 Nonsense 231 763 3 13
ENSDART00000130038 Nonsense 247 779 3 13

The following transcripts of ENSDARG00000001829 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 24723323)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23970201
GRCz11 24 24115375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATCGCCAGGATGGAACAGAAATGAAGCTTTTGATAAGGACACCAATT[T/A]ACAGCACAGCCAAAGAGAGATGAGGGATAGGTCTTATCCAAGACATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024606 Nonsense 89 271 2 9
ENSDART00000111096 Nonsense 581 763 6 13
ENSDART00000130038 Nonsense 597 779 6 13

The following transcripts of ENSDARG00000001829 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 24718930)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23965808
GRCz11 24 24110982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTTTAGTGGCCAAGACATCCCACTCAATGAACGCTTTGCAAATGAA[C/T]AGTATTATTCAATCCCTGATGAGATTAAAGAAGAAGAAGAATATGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link