
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nup155
- Ensembl ID:
- ENSDARG00000001777
- ZFIN ID:
- ZDB-GENE-040426-711
- Description:
- nuclear pore complex protein Nup155 [Source:RefSeq peptide;Acc:NP_956450]
- Human Orthologue:
- NUP155
- Human Description:
- nucleoporin 155kDa [Source:HGNC Symbol;Acc:8063]
- Mouse Orthologue:
- Nup155
- Mouse Description:
- nucleoporin 155 Gene [Source:MGI Symbol;Acc:MGI:2181182]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18970 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18970
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010626 | Essential Splice Site | 968 | 1391 | 24 | 34 |
ENSDART00000137285 | Essential Splice Site | 700 | 1123 | 17 | 27 |
- Genomic Location (Zv9):
- Chromosome 10 (position 1633959)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 1579515 GRCz11 10 1607261 - KASP Assay ID:
- 2260-2714.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGAGAGCCGGAGGAGGACACCAGCGGACAGCAGGCCTTTCAGGAGAGG[T/G]CAGTACACACACACACACTAACACACCAAGCTTCTGCTAAATGCGTTTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: