zgc:110527

Ensembl ID:
ENSDARG00000001767
ZFIN ID:
ZDB-GENE-050220-15
Description:
hypothetical protein LOC503537 [Source:RefSeq peptide;Acc:NP_001012519]
Human Orthologue:
SLC29A2
Human Description:
solute carrier family 29 (nucleoside transporters), member 2 [Source:HGNC Symbol;Acc:11004]
Mouse Orthologue:
Slc29a2
Mouse Description:
solute carrier family 29 (nucleoside transporters), member 2 Gene [Source:MGI Symbol;Acc:MGI:1345278

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39333 Nonsense Mutation detected in F1 DNA During 2018
sa23957 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011551 Nonsense 90 415 5 15
ENSDART00000115338 Nonsense 90 415 5 13
ENSDART00000131646 Nonsense 125 450 5 13

The following transcripts of ENSDARG00000001767 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26805658)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27374569
GRCz11 21 27411264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAAATGGACCGGGACAGCTTCTTTTCCATTACCATGGCAACCATCTG[G/A]TTTATTAACAGTATGTCTCTTATCATTTTAAAGTTAGATGCTGTACATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011551 Essential Splice Site 94 415 6 15
ENSDART00000115338 Essential Splice Site 94 415 6 13
ENSDART00000131646 Essential Splice Site 129 450 6 13

The following transcripts of ENSDARG00000001767 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26805508)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27374419
GRCz11 21 27411114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCACTTTAATTAGCAAATCATCTTATAGAACTCATCATTTTTTGCACA[G/T]TGTTTGGGGCCATTCTGCAAGGTAGTCTTTTTGGTTTGGTTGGGAAACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link