Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
flot1
- Ensembl ID:
- ENSDARG00000001710
- ZFIN IDs:
- ZDB-GENE-000210-36, ZDB-GENE-020430-1, ZDB-GENE-020430-1
- Description:
- flotillin 1 [Source:RefSeq peptide;Acc:NP_570988]
- Human Orthologue:
- FLOT1
- Human Description:
- flotillin 1 [Source:HGNC Symbol;Acc:3757]
- Mouse Orthologue:
- Flot1
- Mouse Description:
- flotillin 1 Gene [Source:MGI Symbol;Acc:MGI:1100500]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa45655 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45655
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000001995 | Essential Splice Site | 71 | 438 | 4 | 12 |
| ENSDART00000139122 | Essential Splice Site | 71 | 431 | 5 | 12 |
- Genomic Location (Zv9):
- Chromosome 19 (position 7564626)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7023165 GRCz11 19 6942090 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGATGTTCTTGATTTTTATATGGACAAACAGAATTGTTTCTCTCCCTC[A/G]GATGAAGATTCAAGGACAGAATAAGCAGATGTTGGCTGCAGCGTGTCAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
