flot1

Ensembl ID:
ENSDARG00000001710
ZFIN IDs:
ZDB-GENE-000210-36, ZDB-GENE-020430-1, ZDB-GENE-020430-1
Description:
flotillin 1 [Source:RefSeq peptide;Acc:NP_570988]
Human Orthologue:
FLOT1
Human Description:
flotillin 1 [Source:HGNC Symbol;Acc:3757]
Mouse Orthologue:
Flot1
Mouse Description:
flotillin 1 Gene [Source:MGI Symbol;Acc:MGI:1100500]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45655 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001995 Essential Splice Site 71 438 4 12
ENSDART00000139122 Essential Splice Site 71 431 5 12
Genomic Location (Zv9):
Chromosome 19 (position 7564626)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7023165
GRCz11 19 6942090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATGTTCTTGATTTTTATATGGACAAACAGAATTGTTTCTCTCCCTC[A/G]GATGAAGATTCAAGGACAGAATAAGCAGATGTTGGCTGCAGCGTGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link