uckl1

Ensembl ID:
ENSDARG00000001686
ZFIN ID:
ZDB-GENE-040724-238
Description:
uridine-cytidine kinase 1-like 1 [Source:RefSeq peptide;Acc:NP_001121731]
Human Orthologue:
UCKL1
Human Description:
uridine-cytidine kinase 1-like 1 [Source:HGNC Symbol;Acc:15938]
Mouse Orthologue:
Uckl1
Mouse Description:
uridine-cytidine kinase 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915806]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21279 Nonsense Available for shipment Available now
sa7135 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030885 Nonsense 60 533 2 15
Genomic Location (Zv9):
Chromosome 8 (position 23868872)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22994690
GRCz11 8 23015929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTAAAACGGAACCTCCACTGCTCCGCACTGGCACACGCACCATCTA[C/A]ACAGCTGGCCGACCCCCTTGGTATAATGAACACGGAGCCCAGTTTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030885 Essential Splice Site 175 533 5 15
Genomic Location (Zv9):
Chromosome 8 (position 23870153)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22995971
GRCz11 8 23017210
KASP Assay ID:
554-5014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTCATTTTGTTTGATCTTTTTTTAATGTGCTCACTCCCTGCTCTTTC[A/G]GAAAAACGTGTACGGTGCCAGCGTCATTATCTTCGAAGGCATCTTATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link