
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92567
- Ensembl ID:
- ENSDARG00000001621
- ZFIN ID:
- ZDB-GENE-040718-491
- Description:
- nuclear transcription factor Y, alpha like [Source:RefSeq peptide;Acc:NP_001002731]
- Human Orthologue:
- NFYA
- Human Description:
- nuclear transcription factor Y, alpha [Source:HGNC Symbol;Acc:7804]
- Mouse Orthologue:
- Nfya
- Mouse Description:
- nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16050 | Essential Splice Site | Available for shipment | Available now |
sa44686 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16050
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003493 | None | 399 | None | 8 | |
ENSDART00000135973 | Essential Splice Site | None | 336 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 8 (position 25887269)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25015187 GRCz11 8 25034326 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATCTGTAGTGGAGCCAATCAGAAGGGAACCGGACAGCCGGAGAAACGG[T/C]AAAGGGTTGCGCTTGCTCTAAGGGAAATGGTAGCTGACAACACGGATTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44686
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003493 | Essential Splice Site | 331 | 399 | 7 | 8 |
ENSDART00000135973 | Essential Splice Site | 268 | 336 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 8 (position 25875611)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25003529 GRCz11 8 25022668 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTCGGGCAAAACTGGAGGCAGAGGGAAAAATCCCTAAAGAGCGAAAGG[T/C]GAGTCTTACATCTTACATCTTCCGAATGCTGTCATATGCGCATCTTGAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: