zgc:92567

Ensembl ID:
ENSDARG00000001621
ZFIN ID:
ZDB-GENE-040718-491
Description:
nuclear transcription factor Y, alpha like [Source:RefSeq peptide;Acc:NP_001002731]
Human Orthologue:
NFYA
Human Description:
nuclear transcription factor Y, alpha [Source:HGNC Symbol;Acc:7804]
Mouse Orthologue:
Nfya
Mouse Description:
nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16050 Essential Splice Site Available for shipment Available now
sa44686 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003493   None 399 None 8
ENSDART00000135973 Essential Splice Site None 336 1 8
Genomic Location (Zv9):
Chromosome 8 (position 25887269)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25015187
GRCz11 8 25034326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTGTAGTGGAGCCAATCAGAAGGGAACCGGACAGCCGGAGAAACGG[T/C]AAAGGGTTGCGCTTGCTCTAAGGGAAATGGTAGCTGACAACACGGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003493 Essential Splice Site 331 399 7 8
ENSDART00000135973 Essential Splice Site 268 336 7 8
Genomic Location (Zv9):
Chromosome 8 (position 25875611)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25003529
GRCz11 8 25022668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCGGGCAAAACTGGAGGCAGAGGGAAAAATCCCTAAAGAGCGAAAGG[T/C]GAGTCTTACATCTTACATCTTCCGAATGCTGTCATATGCGCATCTTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link