si:dkey-89b17.6

Ensembl ID:
ENSDARG00000001572
ZFIN ID:
ZDB-GENE-060503-461
Description:
Novel protein similar to mouse and rat perforin 1 (Pore forming protein) (Prf1) [Source:UniProtKB/Tr
Human Orthologue:
PRF1
Human Description:
perforin 1 (pore forming protein) [Source:HGNC Symbol;Acc:9360]
Mouse Orthologue:
Prf1
Mouse Description:
perforin 1 (pore forming protein) Gene [Source:MGI Symbol;Acc:MGI:97551]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11651 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001821 Essential Splice Site 168 555 1 3
ENSDART00000145003 Essential Splice Site 168 536 1 3
Genomic Location (Zv9):
Chromosome 19 (position 5888217)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5347528
GRCz11 19 5264014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGACAAGTTCTCCTACACRAGTCACACCTTYTCCTGCCGYTATTATTC[G/A]TAAGTCCTGGTGTTTTGACTTTACAATAAGGTTGTATTACTTGTATTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link