sp3

Ensembl ID:
ENSDARG00000001549
ZFIN ID:
ZDB-GENE-070410-111
Description:
transcription factor Sp3 [Source:RefSeq peptide;Acc:NP_001082967]
Human Orthologue:
SP3
Human Description:
Sp3 transcription factor [Source:HGNC Symbol;Acc:11208]
Mouse Orthologue:
Sp3
Mouse Description:
trans-acting transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:1277166]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9751 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001795 Nonsense 18 679 2 7
ENSDART00000123342 Nonsense 30 64 3 3
ENSDART00000131077 Nonsense 30 691 3 9
Genomic Location (Zv9):
Chromosome 9 (position 2761385)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2756857
GRCz11 9 2762877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGGCCACCCCCTTTCATGTATTAAACCCGCCCATCTGCAGGACGGA[C/T]AGCCCTCGCCGCTCGCCCTGCTCGCCGCCACTTGCACCGGCCTCGGTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link