slc2a1a

Ensembl ID:
ENSDARG00000001437
ZFIN ID:
ZDB-GENE-030131-3158
Description:
solute carrier family 2, facilitated glucose transporter member 1 [Source:RefSeq peptide;Acc:NP_001
Human Orthologue:
SLC2A1
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 1 [Source:HGNC Symbol;Acc:11005]
Mouse Orthologue:
Slc2a1
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43972 Nonsense Mutation detected in F1 DNA During 2018
sa43973 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025414 Nonsense 41 488 3 10
Genomic Location (Zv9):
Chromosome 23 (position 22501276)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22280583
GRCz11 23 22207134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCTCATACCCACTTGATAATGTTGTTTTTTTTCTCTCATAGATCATC[G/T]AGGGCTTCTACAATGAGACGTGGCATAACAGGTATTCAGAGTACATTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025414 Essential Splice Site 227 488 6 10
Genomic Location (Zv9):
Chromosome 23 (position 22503185)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22282492
GRCz11 23 22209043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACTTAAGATGTTGCCTGTGCCCTCAGCCTAACTAACTGATTTCCACA[G/T]TGCTAAAGAAGCTGCGTGGCACTGATGATGTGGGCGCAGACATGCAGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link