slc6a13l

Ensembl ID:
ENSDARG00000001354
ZFIN ID:
ZDB-GENE-030616-628
Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 like [Source:RefSeq peptide
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33929 Nonsense Mutation detected in F1 DNA During 2018
sa10303 Nonsense Available for shipment Available now
sa20785 Nonsense Available for shipment Available now
sa18849 Nonsense Mutation detected in F1 DNA During 2018
sa11020 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 301 608 7 14
ENSDART00000143577 Nonsense 287 543 7 13
Genomic Location (Zv9):
Chromosome 6 (position 41085563)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41157163
GRCz11 6 41154699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGAGTTTGTACAGGAGTACTGACTGCACTGGGAAGCTACAACAAATA[T/A]GACAACAACTGCTACAGGTACTTTAGATGATCTTATATCACACTCTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 366 608 9 14
ENSDART00000143577 Nonsense 352 543 9 13
Genomic Location (Zv9):
Chromosome 6 (position 41087417)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159017
GRCz11 6 41156553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KCCTGGTTTGGCGTTCATYGCTTACCCCCGTGCTGTAGCTYTGATGCCTT[T/A]GCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 389 608 10 14
ENSDART00000143577 Nonsense 375 543 10 13
Genomic Location (Zv9):
Chromosome 6 (position 41087574)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159174
GRCz11 6 41156710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTA[T/A]CAGGAAGCCCTGGTTACGTCTATCTCAGATATGTATCCCTCATTCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
Genomic Location (Zv9):
Chromosome 6 (position 41087610)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159210
GRCz11 6 41156746
KASP Assay ID:
2259-7957.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTA[T/A]CCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
Genomic Location (Zv9):
Chromosome 6 (position 41087610)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159210
GRCz11 6 41156746
KASP Assay ID:
2259-7957.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTA[T/A]CCCTCATTYTTCCAAGTTGGACATCGGCGYAAATTTCTTCTCCTCTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link