zgc:153243

Ensembl ID:
ENSDARG00000001210
ZFIN ID:
ZDB-GENE-060825-216
Description:
hypothetical protein LOC751672 [Source:RefSeq peptide;Acc:NP_001074222]
Human Orthologues:
THAP1, THAP3
Human Descriptions:
THAP domain containing, apoptosis associated protein 1 [Source:HGNC Symbol;Acc:20856]
THAP domain containing, apoptosis associated protein 3 [Source:HGNC Symbol;Acc:20855]
Mouse Orthologues:
Thap1, Thap3
Mouse Descriptions:
THAP domain containing, apoptosis associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921004]
THAP domain containing, apoptosis associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:1917126]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001376 Nonsense 185 224 5 5
Genomic Location (Zv9):
Chromosome 7 (position 33959471)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32353811
GRCz11 7 32624961
KASP Assay ID:
554-0904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAGGATCTGTGTGACTGTCTGGACGTGGACTGTATGGGCTGCTTCTA[T/A]CCATGTCCTGAATGTGGCTCTCGGAAGTGTGGTGTCGAATGCCGCTGYGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link