znf384l

Ensembl ID:
ENSDARG00000001015
ZFIN ID:
ZDB-GENE-030616-498
Description:
Novel protein similar to vertebrate zinc finger protein 384 (ZNF384)Znf384l protein [Source:UniProtK
Human Orthologue:
ZNF384
Human Description:
zinc finger protein 384 [Source:HGNC Symbol;Acc:11955]
Mouse Orthologue:
Zfp384
Mouse Description:
zinc finger protein 384 Gene [Source:MGI Symbol;Acc:MGI:2443203]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14743 Essential Splice Site Available for shipment Available now
sa17389 Nonsense Available for shipment Available now
sa12844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001148 Essential Splice Site 21 596 1 11
ENSDART00000104891 Essential Splice Site 21 583 1 10
ENSDART00000141913 Essential Splice Site 21 283 2 7

The following transcripts of ENSDARG00000001015 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7605414)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7063953
GRCz11 19 6982878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCAACTCATCATACTTTTGGTCTCCCGTTCCAACAGTGCAAGGACAG[G/T]TAGACACCTTATTATTGGACTCTCTTGTACTGTACATCGTTGTGTCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001148 Nonsense 332 596 7 11
ENSDART00000104891 Nonsense 319 583 6 10
ENSDART00000141913   None 283 None 7

The following transcripts of ENSDARG00000001015 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7597679)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7056218
GRCz11 19 6975143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACTGCCAGAAAACMTTCAGACAGCTCAGCCATCTACAGCAGCACACA[C/T]GGTACAACTGAGCAATACACCACACACNNCTGCTGCAGGACTYGCTTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001148 Nonsense 495 596 11 11
ENSDART00000104891 Nonsense 482 583 10 10
ENSDART00000141913   None 283 None 7

The following transcripts of ENSDARG00000001015 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7588887)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7047426
GRCz11 19 6966351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACCCAGATCCTCTSACAGTAGCGGCTGCAGTGGCAGCGCAGCAGGCT[C/T]AGAACCCMGGTCAGGGTTCAGGTGGAGGRAGTGGGCGAGGCCGTGGRYGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link