
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
unk
- Ensembl ID:
- ENSDARG00000000935
- ZFIN ID:
- ZDB-GENE-040426-707
- Description:
- RING finger protein unkempt homolog [Source:RefSeq peptide;Acc:NP_956530]
- Human Orthologue:
- UNK
- Human Description:
- unkempt homolog (Drosophila) [Source:HGNC Symbol;Acc:29369]
- Mouse Orthologue:
- Unk
- Mouse Description:
- unkempt homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2442456]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12996 | Nonsense | Available for shipment | Available now |
sa740 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12996
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000001053 | Nonsense | 177 | 737 | 3 | 15 |
ENSDART00000131300 | Nonsense | 177 | 777 | 3 | 15 |
The following transcripts of ENSDARG00000000935 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 37222914)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 35763554 GRCz11 12 36436295 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTCAYTGTGCCTTTGCTCATGGGTCACATGACCTCAGAAGCCCTGTATA[T/G]GACATCAGGTGWGTAGCTGGTCTTCAGAGCAGTATTTCATCTGTATTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa740
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000001053 | Nonsense | 647 | 737 | 14 | 15 |
ENSDART00000131300 | 646 | 777 | 14 | 15 |
The following transcripts of ENSDARG00000000935 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 37190309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 35796159 GRCz11 12 36468900 - KASP Assay ID:
- 554-0647.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATTGTATTTTTTNCTGTCTTAGTCCCTGGCGGTGTTGAAGGCGGATGC[G/T]GAGGACGCTCGTCTACTGGCAGGGCAGCTGGGAATGGAGGCGGARCGAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: