zgc:56699

Ensembl ID:
ENSDARG00000000887
ZFIN ID:
ZDB-GENE-040426-2099
Description:
gametocyte-specific factor 1 [Source:RefSeq peptide;Acc:NP_997998]
Human Orthologue:
GTSF1
Human Description:
gametocyte specific factor 1 [Source:HGNC Symbol;Acc:26565]
Mouse Orthologue:
Gtsf1
Mouse Description:
gametocyte specific factor 1 Gene [Source:MGI Symbol;Acc:MGI:1921424]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13140 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000992 Essential Splice Site 29 182 None 8
ENSDART00000138849 Essential Splice Site 29 182 None 7

The following transcripts of ENSDARG00000000887 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 32340292)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32175182
GRCz11 23 32101713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAGTCCACTCTGAAAGTACAGGGCAGATGTGGAATGAAGACAACGG[T/C]AAKCAATCATCATCATAACTCGATGCACTGTTGAAGTTACATGTGCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link