mapk14a

Ensembl ID:
ENSDARG00000000857
ZFIN ID:
ZDB-GENE-010202-2
Description:
Mitogen-activated protein kinase 14A [Source:UniProtKB/Swiss-Prot;Acc:Q9DGE2]
Human Orthologue:
MAPK14
Human Description:
mitogen-activated protein kinase 14 [Source:HGNC Symbol;Acc:6876]
Mouse Orthologue:
Mapk14
Mouse Description:
mitogen-activated protein kinase 14 Gene [Source:MGI Symbol;Acc:MGI:1346865]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45323 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040362 Nonsense 286 361 11 12

The following transcripts of ENSDARG00000000857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24710789)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23836607
GRCz11 8 23857846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGATCGTTCATTTACTTTCATATTTCGTGTATGCAGCTGTGGACCTCT[T/A]GGAGAAAATGCTGGTTTTGGACACTGATAAGCGGATTACAGCAGCAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link