sly1

Ensembl ID:
ENSDARG00000000779
ZFIN ID:
ZDB-GENE-030116-3
Description:
sec1 family domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_878281]
Human Orthologue:
SCFD1
Human Description:
sec1 family domain containing 1 [Source:HGNC Symbol;Acc:20726]
Mouse Orthologue:
Scfd1
Mouse Description:
Sec1 family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924233]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23101 Essential Splice Site Available for shipment Available now
sa42953 Nonsense Mutation detected in F1 DNA During 2018
sa23100 Nonsense Available for shipment Available now
sa42952 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104166 Essential Splice Site 94 632 4 25
ENSDART00000134735 Essential Splice Site 94 623 4 25
Genomic Location (Zv9):
Chromosome 17 (position 28852678)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28776605
GRCz11 17 28793568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTACTTTATAATGCCCACAGAGGAGAACATCGACAGGATATGTCAA[G/A]TAAATATGCTTGTTTTGGTCAGTCCCATTCAAAGATAATTTGTTTGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104166 Nonsense 106 632 5 25
ENSDART00000134735 Nonsense 106 623 5 25
Genomic Location (Zv9):
Chromosome 17 (position 28852563)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28776490
GRCz11 17 28793453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGCTCCATCACAGGACCTCCGAAACCAACTATATGAGTCCTACTATT[T/A]GAACTTCATCTCCGCAATTTCCAGAAGCAAATTGGAGGATATAGCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104166 Nonsense 281 632 11 25
ENSDART00000134735 Nonsense 281 623 11 25
Genomic Location (Zv9):
Chromosome 17 (position 28845973)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28769900
GRCz11 17 28786863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTCTATTAACCAACCAATCCCCCATATTAGGACTTCCACCTGAAC[C/T]GAGTGAGTGTGGACGAGTCTCATGGGTCAGAGGCCAGTCCAGCCGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104166 Nonsense 530 632 19 25
ENSDART00000134735 Nonsense 530 623 19 25
Genomic Location (Zv9):
Chromosome 17 (position 28836887)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28760814
GRCz11 17 28777777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAACACCGGCTCCCAGTTTGTGATGGAGGGAGTGAAAAATCTGGTCT[T/A]GAAACAGCATGTGAGTATTTAATAGCACTTAAGGAAATAAAAATCATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link