spi1

Ensembl ID:
ENSDARG00000000767
ZFIN ID:
ZDB-GENE-980526-164
Description:
transcription factor PU.1 [Source:RefSeq peptide;Acc:NP_932328]
Human Orthologue:
SPI1
Human Description:
spleen focus forming virus (SFFV) proviral integration oncogene spi1 [Source:HGNC Symbol;Acc:11241]
Mouse Orthologue:
Sfpi1
Mouse Description:
SFFV proviral integration 1 Gene [Source:MGI Symbol;Acc:MGI:98282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16105 Essential Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000841   None 192 None 5
ENSDART00000036729 Nonsense 250 297 6 6
ENSDART00000093279 Nonsense 219 266 5 5
ENSDART00000126831 Essential Splice Site 219 220 5 6
ENSDART00000129949   None 162 None 4
Genomic Location (Zv9):
Chromosome 7 (position 33980476)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32374816
GRCz11 7 32645966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACAAAGAGGTTTTAGCCAACCGATGGGGCATCCAGAAGGGCAATCGC[A/T]AAAAGATGACCTACCAGAAGATGGCAAGAGCACTGAGAAACTACGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link