znf511

Ensembl ID:
ENSDARG00000000760
ZFIN ID:
ZDB-GENE-030616-621
Description:
Zinc finger protein 511 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZZ00]
Human Orthologue:
ZNF511
Human Description:
zinc finger protein 511 [Source:HGNC Symbol;Acc:28445]
Mouse Orthologue:
Zfp511
Mouse Description:
zinc finger protein 511 Gene [Source:MGI Symbol;Acc:MGI:1917002]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11298 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000831 Nonsense 209 277 5 6
ENSDART00000125625 Nonsense 239 308 4 6
Genomic Location (Zv9):
Chromosome 13 (position 24889638)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24535298
GRCz11 13 24665748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTAAGCATGATAATCACATCAACAGAACAACAGAAAMAAAGACTCAA[C/T]AGAAGAAGGATGCACATATGGAAGTTTCWGCAACCGYTCTGCAACAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link