slc6a13

Ensembl ID:
ENSDARG00000000730
ZFIN ID:
ZDB-GENE-030616-629
Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:RefSeq peptide;Acc:
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20784 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001861 Nonsense 72 584 2 14
ENSDART00000103758 Nonsense 72 353 4 10
ENSDART00000128723 Nonsense 72 168 4 7
ENSDART00000132484 Nonsense 72 575 2 14
Genomic Location (Zv9):
Chromosome 6 (position 41065784)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41137384
GRCz11 6 41134920
KASP Assay ID:
2259-7952.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAAAAACAGCTGCATTTTTCTGTTTTAGGAGTGTTTTTTATTCCATA[T/G]GTGGTCTTTTTGTTTGCCTGTGGCATTCCTCTCTTTCTAATGGAAACTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link