sypl2b

Ensembl ID:
ENSDARG00000000690
ZFIN ID:
ZDB-GENE-050417-309
Description:
synaptophysin-like 2b [Source:RefSeq peptide;Acc:NP_997834]
Human Orthologue:
SYPL2
Human Description:
synaptophysin-like 2 [Source:HGNC Symbol;Acc:27638]
Mouse Orthologue:
Sypl2
Mouse Description:
synaptophysin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1328311]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7137 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34403 Nonsense Mutation detected in F1 DNA During 2018
sa15615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000744 Essential Splice Site None 232 1 6
Genomic Location (Zv9):
Chromosome 8 (position 25932509)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25060427
GRCz11 8 25079566
KASP Assay ID:
554-4836.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAGGAACTTTGACAACNTTTTTGGTATTTGTCTGGTGACTACACAAGG[T/G]AAGCTTTCTGAATTTGACTTATTTTAYTGTAAKRCAACATAWCACGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000744 Nonsense 70 232 4 6
Genomic Location (Zv9):
Chromosome 8 (position 25935812)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25063730
GRCz11 8 25082869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATTCCCCTTAATTTTTTTTGTTTAAAAGGCTCAATACGCAGAGTTA[C/A]AAAGTCCCAACCTGCGAAGCCAATTCAACAACCTTTCGAACCAGACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000744 Nonsense 83 232 4 6
Genomic Location (Zv9):
Chromosome 8 (position 25935849)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25063767
GRCz11 8 25082906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAYGCAGAGTTACAAAGTCCCAACCTGCGAAGCCAATTCAACAACYYTT[C/T]GAACCAGACAGCTGACYGGAGACCATTCATCATCAGCTGAGTTCTTTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link