
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ell
- Ensembl ID:
- ENSDARG00000000568
- ZFIN ID:
- ZDB-GENE-030131-3946
- Description:
- elongation factor RNA polymerase II [Source:RefSeq peptide;Acc:NP_956001]
- Human Orthologue:
- ELL
- Human Description:
- elongation factor RNA polymerase II [Source:HGNC Symbol;Acc:23114]
- Mouse Orthologue:
- Ell
- Mouse Description:
- elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11958 | Essential Splice Site | Available for shipment | Available now |
sa16550 | Essential Splice Site | Available for shipment | Available now |
sa12948 | Nonsense | Available for shipment | Available now |
sa43827 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11958
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032770 | Essential Splice Site | 45 | 597 | 1 | 11 |
ENSDART00000100642 | Essential Splice Site | 72 | 660 | 1 | 12 |
- Genomic Location (Zv9):
- Chromosome 22 (position 21244726)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20899402 GRCz11 22 20924380 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCTGACAGACAGCGCTCTGCGGGCGTTTRAGGACTACCAGAGCAACAAG[G/A]TAAGACGCGCGTCGAGCGCAACGCGAGGCTGGATAAAYAGAGCTAACAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16550
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032770 | Essential Splice Site | 101 | 597 | 3 | 11 |
ENSDART00000100642 | Essential Splice Site | 128 | 660 | 3 | 12 |
- Genomic Location (Zv9):
- Chromosome 22 (position 21197280)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20851956 GRCz11 22 20876934 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAGACAATCCCCAGGGCAGCTTCGACTGCATTCAGCAGTACATTACAAG[G/A]TAAGAACAAAATTAAAYGTATMTTTYATTGTAGTGCTGTGATTWGTGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12948
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032770 | Nonsense | 318 | 597 | 8 | 11 |
ENSDART00000100642 | Nonsense | 345 | 660 | 8 | 12 |
- Genomic Location (Zv9):
- Chromosome 22 (position 21176548)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20831224 GRCz11 22 20856202 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAAGTTGTGTAATATTTGACTTCAGTTGAACACCCACAACCCCCAGAAA[C/T]GACCTGCAGCCGACTTCATCGATCCCCTGGCCAATAAGAAACCCAGAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43827
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032770 | Nonsense | 433 | 597 | 8 | 11 |
ENSDART00000100642 | Nonsense | 460 | 660 | 8 | 12 |
- Genomic Location (Zv9):
- Chromosome 22 (position 21176202)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20830878 GRCz11 22 20855856 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCGACACAAGAGGAAAGGCAGACCTCCATGTCCCCACCCCACAGCAGTT[T/A]GGACAGCTCTCTGACCCAGACCACCCAACCCTCTCTGCACGGCAAGTCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: