slc1a4

Ensembl ID:
ENSDARG00000000551
ZFIN ID:
ZDB-GENE-030616-566
Description:
neutral amino acid transporter A [Source:RefSeq peptide;Acc:NP_001002513]
Human Orthologue:
SLC1A4
Human Description:
solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Slc1a4
Mouse Description:
solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 Gene [Source:MGI Symbol

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22290 Essential Splice Site Available for shipment Available now
sa10198 Essential Splice Site Available for shipment Available now
sa42202 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043004 Essential Splice Site 187 517 3 7
ENSDART00000057584 Essential Splice Site 209 539 4 8
ENSDART00000127741 Essential Splice Site 209 325 4 6
Genomic Location (Zv9):
Chromosome 13 (position 24663486)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24309146
GRCz11 13 24439596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAATGTAAGCCACTTTAAACCAATGGAAAACATGGTCTGGTGGGTTTC[A/T]GGTTCCCTTTGGAACAGACACAGATGGAATGAATATTCTGGGTCTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043004 Essential Splice Site 242 517 3 7
ENSDART00000057584 Essential Splice Site 264 539 4 8
ENSDART00000127741 Essential Splice Site 264 325 4 6
Genomic Location (Zv9):
Chromosome 13 (position 24663316)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24308976
GRCz11 13 24439426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATGCCTTCAATRAAGCCACTATGGTGCTTGTGTCCTGGATCATGTGG[T/C]AAGTRAAGAWCTTTGATCAAGTCTTTGACATCTAATCCAGTAAAATACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043004 Nonsense 340 517 5 7
ENSDART00000057584 Nonsense 362 539 6 8
ENSDART00000127741   None 325 None 6
Genomic Location (Zv9):
Chromosome 13 (position 24660006)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24305666
GRCz11 13 24436116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCCCACCATGATGAAGTGTGTAGAGGAGAACAACGGTGTCGACAAA[C/T]GAATCAGTCGGTTCATTTTACCTATCGGAGCCACTGTTAACATGGATGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link