ankar

Ensembl ID:
ENSDARG00000000516
ZFIN ID:
ZDB-GENE-030616-533
Description:
ankyrin and armadillo repeat containing isoform 2 [Source:RefSeq peptide;Acc:NP_001035135]
Human Orthologue:
ANKAR
Human Description:
ankyrin and armadillo repeat containing [Source:HGNC Symbol;Acc:26350]
Mouse Orthologue:
Ankar
Mouse Description:
ankyrin and armadillo repeat containing Gene [Source:MGI Symbol;Acc:MGI:2442559]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30922 Nonsense Mutation detected in F1 DNA During 2018
sa41501 Nonsense Mutation detected in F1 DNA During 2018
sa34717 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536   None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
ENSDART00000000536   None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
Genomic Location (Zv9):
Chromosome 9 (position 42148426)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41273596
GRCz11 9 41075383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTTGCTTA[T/A]CTCAAACTCATCTCGTTCCTTGTGCCACTGCTCATTTCTTTGAGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536   None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
ENSDART00000000536   None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
Genomic Location (Zv9):
Chromosome 9 (position 42148426)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41273596
GRCz11 9 41075383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTTGCTTA[T/A]CTCAAACTCATCTCGTTCCTTGTGCCACTGCTCATTTCTTTGAGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536 Nonsense 58 644 2 13
ENSDART00000100342 Nonsense 773 1400 11 23
ENSDART00000125843 Nonsense 751 1328 10 21
Genomic Location (Zv9):
Chromosome 9 (position 42132429)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41257599
GRCz11 9 41059386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGCAGTGCATGGCTACAGCGGTCCTGTGTCATATGACGGAAAACTCA[C/T]AAGTCTGTGAAGAACTGGTGCATCATGGTGCTGTACCGATTCTGATCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link