stx1b

Ensembl ID:
ENSDARG00000000503
ZFIN ID:
ZDB-GENE-000330-4
Description:
syntaxin-1B [Source:RefSeq peptide;Acc:NP_571598]
Human Orthologue:
STX1B
Human Description:
syntaxin 1B [Source:HGNC Symbol;Acc:18539]
Mouse Orthologue:
Stx1b
Mouse Description:
syntaxin 1B Gene [Source:MGI Symbol;Acc:MGI:1930705]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081951 Nonsense 150 288 6 10
ENSDART00000082137 Nonsense 149 225 6 9
ENSDART00000128966 Nonsense 150 288 6 10
Genomic Location (Zv9):
Chromosome 19 (position 5798864)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5258175
GRCz11 19 5174661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACACCACGCAGTCYAAATACAGGGACCGCTGCAAGGACCGTATTCAG[A/T]GACAACTGGAAATTAGTGAGTTCTGCTTGCACATACACMCCCACACGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link